Skip to content

FDA November 2014 Products Receiving Orphan Designation

November 29, 2014

 

 

 

 

The chart below identifies FDA November 2014 Products Receiving Orphan Designation as of 11/29/14 in ascending “Orphan Drug Designation Date” order.

FDA November 2014 Products Receiving Orphan Designation

# Generic Name/ODD Date Sponsor Company Indication
1  d6-tetrabenazine, deutetrabenazine/ 11.05 Auspex Pharmaceuticals Huntington’s Disease
2 Adeno-associated viral vector serotype 2 containing the human Rab escort protein 1 gene/ 11.05 NightstaRx Choroideremia
3 stem/progenitor cells derived from ex vivo expanded allogeneic umbilical cord blood cells/ 11.13 Gambia Cell Ltd Hodgkin lymphoma
4 stem/progenitor cells derived from ex vivo expanded allogeneic umbilical cord blood cells/ 11.13 Gambia Cell Ltd Myelodysplastic syndrome
5 stem/progenitor cells derived from ex vivo expanded allogeneic umbilical cord blood cells/ 11.13 Gambia Cell Ltd Acute lymphoblastic leukemia
6 Autologous CD3+ T cells transduced with retroviral vector containing a chimeric antigen receptor directed against CD19 (Autologous CD3+ T cells containing CD19 chimeric antigen receptor)/ 11.13 Juno Therapeutics Acute lymphoblastic leukemia (ALL)
7 (S)-perillyl alcohol temozolomide/ 11.14 NeOnc Technologies Glioma
8 Antagonist of the complement 5a receptor/ 11.17 ChemoCentryx Atypical hemolytic uremic syndrome (aHUS)
9 Anti-tumor necrosis factor (TNF) polyclonal antibody (bovine)/ 11.17 Avaxia Biologics Pediatric ulcerative colitis
10 Cannabidiol/ 11.17 Insys Therapeutics Pediatric Schizophrenia
11 Trehalose/ 11.17 BioBlast Pharma (Israel) Spinal cerebellar ataxia type 3 (SCA3/  Machado Joseph disease)
12 Vatiquinone/ 11.17 Edison Pharmaceuticals Rett Syndrome
13 Recombinant neuroglobin (rNgb) containing mutations H64Q/C46G/C55S/C120S/ 11.17 University of Pittsburgh Carbon monoxide poisoning
14 Veltuzumab/ 11.17 Immunomedics Pemphigus
15 (S)-3-((3-(1-((6-((3,4-dimethoxyphenyl)pryazin-2-yl)amino)ethyl)phenyl)carbamoyl)-5-methylpridin-1-ium/ 11.17 Pulmokine, Inc Pulmonary arterial hypertension (PAH)
16 (S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride/ 11.17 Khondrion BV (Netherlands) Inherited mitochondrial respiratory chain diseases
17 N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide/ 11.17 Catabasis Pharmaceuticals Duchenne muscular dystrophy (DMD)
18 N-(2-amino-2-oxoethyl)-2-(2-((4-fluorophenethyl)amino)-N-isobutylacetamido)-N-(3-(2-oxopyrrolidin-1-yl)propyl)acetamide N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)propyl}-carbamoyl}-methyl)-2-[2-(2-fluorophenyl)-ethylamino]-N-isobutyl-acetamide/ 11.17 Bionure Farma SL (Spain) Optic neuritis
19 IN-(9-methoxynonyl)-1-deoxynojirimycin hydrochloride/ 11.17 Unither Virology, LLC Acute dengue illness
20 Oxytocin/ 11.24 Pr Maithe Tauber (France) Prader-Willi syndrome
21 PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5’TCATCATTTTGTCATTTTGTCATT 3′/ 11.24 Mid-Atlantic BioTherapeutics Rabies virus infections
22 Chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2 / 11.25 BioMarin Pharmaceutical MPS IIIB, Sanfilippo Syndrome Type B
23 225Ac-lintuzumab/ 11.25 Actinium Pharmaceuticals Acute myelogenous leukemia

.

** Generic Name/ODD Date” Column Link = Is the FDA Orphan Drug Product Designation Database Record.

Please Note : “Two small test tubes held in spring clamps” courtesy of  Amitchell125 at English Wikipedia [CC-BY-SA-30] | Wikimedia Commons.

Copyright © 2012-2014, Orphan Druganaut Blog. All rights reserved.

Advertisements
Leave a Comment

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

%d bloggers like this: